Home About us Current issue Back issues Submission Instructions Advertise Contact Login   

Search Article 
  
Advanced search 
 
Saudi Journal of Kidney Diseases and Transplantation
Users online: 65 Home Bookmark this page Print this page Email this page Small font sizeDefault font size Increase font size 
 


 
Table of Contents   
RENAL DATA FROM THE ARAB WORLD  
Year : 2012  |  Volume : 23  |  Issue : 5  |  Page : 1090-1098
Clinical characterization and NPHP1 mutations in nephronophthisis and associated ciliopathies: A single center experience


1 Department of Pediatrics, Kasr Al Ainy School of Medicine; Center of Pediatric Nephrology and Transplantation, Cairo University; Egyptian Group for Orphan Renal Diseases, Cairo, Egypt
2 Department of Pediatrics, University of Michigan, Howard Hughes Medical Institute, Michigan, USA
3 Department of Pediatrics, Cairo University, Cairo, Egypt
4 Department of Pathology, Cairo University, Cairo, Egypt
5 Department of Pediatric Ophthalmology, Cairo University, Cairo, Egypt
6 Department of Radiology, Cairo University, Cairo, Egypt

Click here for correspondence address and email

Date of Web Publication13-Sep-2012
 

   Abstract 

Nephronophthisis (NPHP) is a recessive disorder of the kidney that is the leading genetic cause of end-stage renal failure in children. Egypt is a country with a high rate of consan­guineous marriages; yet, only a few studies have investigated the clinical and molecular charac­teristics of NPHP and related ciliopathies in the Egyptian population. We studied 20 children, from 17 independent families, fulfilling the clinical and the ultrasonographic criteria of NPHP. Analysis for a homozygous deletion of the NPHP1 gene was performed by polymerase chain reaction on the genomic DNA of all patients. Patients were best categorized as 75% juvenile NPHP, 5% infantile NPHP, and 20% Joubert syndrome-related disorders (JSRD). The mean age at diagnosis was 87.5 + 45.4 months, which was significantly late as compared with the age at onset of symptoms, 43.8 ± 29.7 months (P <0.01). Homozygous NPHP1 deletions were detected in six patients from five of 17 (29.4%) studied families. Our study demonstrates the clinical phenotype of NPHP and related disorders in Egyptian children. Also, we report that homozygous NPHP1 deletions account for 29.4% of NPHP in the studied families in this cohort, thereby confirming the diagnosis of type-1 NPHP. Moreover, our findings confirm that NPHP1 deletions can indeed be responsible for JSRD.

How to cite this article:
Soliman NA, Hildebrandt F, Otto EA, Nabhan MM, Allen SJ, Badr AM, Sheba M, Fadda S, Gawdat G, El-Kiky H. Clinical characterization and NPHP1 mutations in nephronophthisis and associated ciliopathies: A single center experience. Saudi J Kidney Dis Transpl 2012;23:1090-8

How to cite this URL:
Soliman NA, Hildebrandt F, Otto EA, Nabhan MM, Allen SJ, Badr AM, Sheba M, Fadda S, Gawdat G, El-Kiky H. Clinical characterization and NPHP1 mutations in nephronophthisis and associated ciliopathies: A single center experience. Saudi J Kidney Dis Transpl [serial online] 2012 [cited 2014 Sep 21];23:1090-8. Available from: http://www.sjkdt.org/text.asp?2012/23/5/1090/100968

   Introduction Top


Nephronophthisis (NPHP) is an autosomal-recessive cystic kidney disease that constitutes the most frequent genetic cause of end-stage renal disease (ESRD) in the first three decades of life. [1],[2],[3] The NPHP-medullary cystic kidney disease (NPHP-MCKD) complex describes a distinct clinico-pathologic entity of inherited diseases that lead to chronic renal failure on the pathologic basis of a chronic sclerosing tubulointerstitial nephritis. [4] Three clinical forms of NPHP have been distinguished based on the age at onset of ESRD: infantile, [5] juvenile, [6] and adolescent NPHP, [7] which manifest with ESRD at the me­dian ages of one, 13, and 19 years, respec­tively. NPHP can be associated with retinitis pigmentosa (Senior-Loken syndrome), liver fibrosis, cerebellar vermis aplasia [Joubert syn­drome (JBTS)], and ocular motor apraxia type Cogan. [8],[9],[10],[11]

Because of the mild nature of symptoms and the lack of edema, hypertension, or urinary tract infections, there is often a delay in the diag­nosis of NPHP. [12] The most useful imaging technique in NPHP is ultrasonography. Kid­neys are of normal or moderately reduced size and show increased echogenicity, loss of cortico-medullary differentiation, and, in later stages, cyst formation at the cortico-medullary border. [13] Renal histology reveals a characteristic triad of tubular basement membrane thickening and disruption, interstitial infiltration and fibrosis, and tubular atrophy and dilatation, with or with­out cyst formation. [14]

Molecular genetic analysis is the only diag­nostic procedure by which the diagnosis of NPHP-1, NPHP-2, or NPHP-3 can be made with certainty. However, due to the presence of additional loci for NPHP, the lack of detec­tion of mutations in the NPHP1 gene does not exclude the diagnosis of NPHP. If molecular genetic diagnostics do not detect a molecular defect, the diagnosis of NPHP can be based on the combined results of typical clinical history with polyuria, polydipsia and anemia; the clas­sical appearance of the kidney on ultrasound and renal histology. [14] The appropriate diagno­sis of NPHP is important not only for antici­pating progressive renal failure but also for the implications on genetic counseling.

Twelve genes have been implicated in NPHP: NPHP1, [15],[16] NPHP2/INVS, [17] NPHP3, [18] NPH-P4, [19],[20] NPHP5/IQCB1, [21] NPHP6/CEP290, [22],[23] NPHP7/GLIS2, [24] NPHP8/RPGRIP1L, [25]-[27] NP-HP9/NEK8, [28] TMEM67, [29] TTC21B, [30] and XP-NPEP3. [31] Recently, massively parallel resequencing mutation analysis of 18 different NPHP-associated ciliopathy genes in 120 as­certained patients led to the identification of 57 mutated alleles, comprising 43 different mutations in 30 unrelated patients. [32]

Homozygous deletions in the NPHP1 gene account for approximately 21% of all NPHP cases, whereas the other genes contribute to less than 3% each. Interestingly, through posi­tional cloning, many of the causative muta­tions have been mapped to genes involved in centrosome and cilia function. This had contri­buted to a unifying theory that defines cystic kidney diseases as "ciliopathies" based on the finding that all proteins mutated in cystic kid­ney diseases of humans or animal models are expressed in the primary cilia or centrosomes of renal epithelial cells. [33]

Little is known about the clinical characteri­zation of NPHP and associated ciliopathies in the region, let alone the genetic molecular data on children afflicted with these diseases. This study was conducted to characterize the clin­ical phenotypes of infants and children with NPHP, whether isolated (only renal affection) or in the context of a complex ciliopathy (with one or more extra-renal associations). Additio­nally, we investigated the prevalence of NPHP1 mutations among the study group.


   Patients and Methods Top


Patients

Children with a clinical diagnosis of NPHP, referred to the Center of Pediatric Nephrology and Transplantation, Cairo University, over a period of one year (early 2008-early 2009) were enrolled in this study. The clinical fea­tures of NPHP include presentation in the first two decades of life with symptoms of polyuria and polydipsia and signs of growth retardation and anemia. Renal ultrasound evaluation in NPHP demonstrates increased echogenicity, small to normal kidney size, and loss of cortico-medullary differentiation or small cysts at the cortico-medullary junction. Kidney biopsy, considered characteristic of NPHP, includes tubu­lar atrophy with tubular basement membrane disruption, interstitial cellular infiltrates with fibrosis, and microcyst development.

We categorized the studied patients according to their clinical phenotype. The majority of en­rolled patients had isolated NPHP, but a subset of patients had extra-renal manifestations, which included retinal degenerative changes, ocular motor apraxia, cerebellar vermis aplasia, and hepatic fibrosis [Table 1]. Individuals were examined for recessive NPHP1 mutation irres­pective of the presence or absence of their extra-renal manifestations. Informed consent was obtained from the parents of affected chil­dren. This study was approved by the Institu­tional Review Board at Cairo University Chil­dren's Hospital.
Table 1: Summary of clinical characteristics of the studied subjects.

Click here to view


History taking included two generation family pedigree, age at onset of symptoms (polyuria, polydipsia, and secondary enuresis), age at onset of ESRD and renal replacement therapy (RRT), if any, as well as any visual or neuro­logical symptoms. Clinical assessment inclu­ded physical growth (height and weight centiles) and blood pressure (BP) measurement. Ano­malies or signs of extra-renal involvement were documented. All patients had full ophthalmologic evaluation to rule out ocular motor apraxia and retinal degeneration.

Laboratory investigations included hemoglo­bin level, urine analysis, blood urea nitrogen (BUN), serum creatinine, and calculation of the glomerular filtration rate (GFR) at the time of presentation using modified Schwartz formula. [34],[35]

Imaging

Abdominal ultrasonography was done for proper assessment of renal size, echogenicity, cortico-medullary differentiation, and to detect the presence of renal cysts, if any. [13] It was also done to rule out congenital hepatic fibrosis as an extra-renal association (General Electric, Vivid 3 Pro, SyncMaster 591S device with a 3.5-7 MHz probe). All cases were examined by the same operator to avoid inter-observer variability. Magnetic resonance imaging (MRI) of the brain was performed in the subset of patients with clinical extra-renal neurological involvement to demonstrate the distinctive "molar tooth sign."

Histopathology

Renal biopsy specimens were obtained, follo­wing informed parental consent, from eight of 20 patients. Kidney biopsy was not done in the remaining 12/20 patients as a result of medical contraindications (small renal size and/or un­controllable hypertension) or parental decline to consent the procedure.

Mutational analysis

Genomic DNA was extracted from blood samples collected in EDTA tubes using the QIAGEN Blood and Cell Culture DNA kit according to the manufacturer's instructions (Qiagen, Valencia, CA, USA). Polymerase chain reaction (PCR) for mutation analysis was per­formed in the Hildebrandt laboratory, Ann Arbor Michigan. Cost was defrayed from the laboratory's research funds. All individuals were screened for homozygous NPHP1 dele­tions, the most common cause of NPHP. Ana­lysis for a homozygous deletion of the NPHP1 gene was performed by a multiplex PCR ap­proach on genomic DNA of patients described earlier. [32] Three pairs of primers amplifying three different exons of the NPHP1 gene (exons 5, 7, and 20) were PCR amplified in a single PCR reaction together with two control primer pairs from another gene (LHX9) from chromo­some 1. Primers against two exons of LHX9 were used as internal controls to test for the presence of sufficient DNA and PCR accu­racy. The primer sequences (5' > 3') used for the analysis are as follows: NPHP1-Exon5-Forward, CACTCATAGCTGGTCTGTTCTTG; NPHP1- Exon5-Reverse, CAGGTGTACAG-GCAGAGTTTTC; NPHP1-Exon7-Forward, TGTTTTTACTGGAGGGTTAGGTG; NPHP1-Exon7-Reverse, CAGGTGTACAGGCAGAG-TTTTC; NPHP1-Exon20-Forward, AATG-GCACCCTCCATCCTAC NPHP1-Exon20-Reverse, AATCGTGGAGGATCCATCTG; LHX9-Exon4-Forward, ATATGGCTCTGCC-TTGCTTC; LHX9-Exon4-Reverse, TTGGG-CAA-AACACACTCTTG; LHX9-Exon6-For-ward, ACCCCTAAAAGCCAAGTTGC; and LHX9-Exon6-Reverse, CCTAATAGTGTCT-TTGTCTTCACTGC. One PCR reaction was set up by mixing 8 μL water (PCR-grade, 10 μL HotStarTaq® Master Mix (Qiagen), 0.1 μL of each primer (10 uM each), and 1 μL DNA (100 ng/μL). The following touchdown PCR protocol was used:

Initial denaturation: 94°C for 15 min; 24 cycles with an annealing temperature decreasing 0.7°C per cycle, starting at 72°C for 30 s; denaturation at 94°C for 30 s, and extension at 72°C for one min; addition of 24 cycles using a fixed low-annealing temperature of 55°C for 30 s and denaturation at 94°C for 30 s and extension at 72°C for one min; final extension was at 72°C for 10 min. About 10 μL of the PCR reaction was electrophoretically sepa­rated on a 1.5% agarose gel for 90 min at 150 V. Lack of amplification products of all three NPHP1 exons, was considered as a homozygous deletion in NPHP1.


   Data Analysis Top


Numerical data were expressed as median and range. P-value less than 0.05 was consi­dered significant.


   Results Top


Twenty children from 17 families with renal findings of NPHP were included in this study. Sex distribution among the affected patients showed a slight preponderance of females, with a ratio of 1.2:1 (11 females and nine males). Seventy-five percent (15/20) were the products of consanguineous marriages. It is notable that the percentage of affected siblings was strikingly high, 65% (13/20 patients) and, likewise, the percentage of sibling death due to NPHP, which accounted for 40% (8/20) of the patients. This finding, together with the high degree of consanguinity, strongly suggests an autosomal-recessive mode of inheritance [Table 1].

While the median age of onset of symptoms in patients was 48 months (range 3-108 months), the median age at diagnosis was significantly delayed at 108 months (range 5-168 months) (P <0.01).

Fifteen of 20 patients (75%) presented with signs of ESRD. All the patients suffered from anemia and growth retardation when they first came to medical attention. Nineteen of 20 pa­tients (95%) had a history typical of NPHP, with symptoms of polydipsia, polyuria, and se­condary enuresis [Table 1]. Four of 20 patients (20%) were hypertensive, with elevated blood pressure above the 95 th percentile for age, gen­der, and height.

Clinically, the study patients were best cate­gorized as: 13/20 (65%) patients with isolated juvenile NPHP and 3/20 (15%) patients as infantile NPHP, while the remaining 4/20 (20%) patients had extra-renal associations and, hence, were clinically categorized as JSRD, namely cerebello-oculo-renal syndrome (CORS).

We found extra-renal symptoms in 20% (4/20) of the study patients with neurological (mental retardation, ataxia, and MTS) and ophthalmologic (retinal degenerative changes and OMA) manifestations as the most fre­quently reported [Table 2]. These four patients were categorized as syndromic juvenile NPHP, and three of them had ESRD at the time of diagnosis (age 84-168 months), whereas the fourth was defined as chronic kidney disease (CKD) stage III at the age of 84 months. Homozygous deletions in the NPHP1 gene were identified in six patients from five inde­pendent families out of the 17 studied families (29.4%). Five patients had isolated NPHP, whereas the sixth patient was among the JSRD group [Figure 1] with the unique MTS detec­ted in his brain MRI images [Figure 2]. The clinical and genetic characteristics of all the study patients are demonstrated in [Table 3].
Figure 1: Algorithm depicting characteristics of the study patients.

Click here to view
Figure 2: (a) Axial brain MRI scan of case no. 15 showing MTS with elongated superior cerebellar peduncles (arrows); (b) renal sonogram of patient no. 7 showing hyperechogenic kidney with multiple cortico-medullary and cortical cysts.

Click here to view
Table 2: Extra-renal manifestations in four (20%) of the study patients.

Click here to view
Table 3: Clinical and genetic characteristics of the study patients.

Click here to view



   Discussion Top


In this report, we studied a cohort of 20 patients with NPHP. The common criterion in the study patients was the renal involvement. Of this cohort, six patients had positive homozygous deletion of NPHP1 gene; five children had isolated NPHP and one patient had JSRD or CORS. Of the 16 patients with isolated NPHP, five patients had homozygous deletion of NPHP1 gene. Interestingly, four of these patients were clinically diagnosed as juvenile NPHP, where­as the fifth patient had the classical phenotype of infantile NPHP (NPHP type-2). This patient showed most of the clinical and histopathological features of NPHP type-2 previously re­ported in the literature, [4],[17],[37] and had been re­ported recently as the first patient with the clinical phenotype of infantile NPHP, yet with documented homozygous deletion of the NPHP1 gene. [38]

Infantile NPHP, frequently caused by muta­tions in the NPHP2/inversin gene, differs from the other types of NPHP by the early age of onset of ESRD, usually less than five years in all reported cases, whereas the median age of ESRD in juvenile NPHP (NPHP type-1 or type-4) is about 13 years. [17] Renal cortical microcysts is another criterion where detailed ana­lysis of a murine model of NPHP2/inversin demonstrates cystic dilatation of Bowman's capsule, proximal tubule, thick ascending limb, and collecting duct. [39]

Co-occurrence of extra-renal findings was observed in four of the study patients (20%), two of whom were siblings. The retinal dege­nerative changes and neurological involvement are the most frequently reported [Table 2]. It is worth mentioning that there was a striking phenotypic heterogeneity between the two des­cribed siblings, although they both tested ne­gative for NPHP1 homozygous deletion. The two siblings shared NPHP and retinal dystro­phy; nevertheless, the younger brother lacked MTS, OMA, and ataxia described in his elder sibling.

In this subset of study patients categorized as JSRD, only one had homozygous deletion of NPHP1 gene. This patient had both neurologi­cal and ophthalmologic involvement as extra-renal manifestations. Notably, he had a more severe form of neurological involvement as compared with the other three JSRD patients who had no NPHP1 mutational defect. His mental capabilities were profoundly compro­mised with seizures and his ataxic manifes­tations were more pronounced as compared with the non-NPHP1 JSRD patients.

Marked intra-familial variability of associa­ted extra-renal symptoms was observed by Caridi et al in familial cases of JSRDs with homozygous deletion of NPHP1 (nephrocystin). [40] They reported neurological defects va­rying from subtle involvement of cerebellum with thickened peduncle to JSRD, showing the typical neurological signs of JBTS (hypotonia, ataxia, psychomotor delay, and oculomotor apraxia-type Cogan).

In contrast, Parisi et al reported that the sub­set of JBTS patients with an NPHP1 deletion have a form of JBTS at the mild end of the cli­nical spectrum for this disorder, as they were not severely mentally retarded and lacked the respi­ratory disturbance often seen in this disorder. [41]

The fourth patient described in this work as JSRD had more extra-renal manifestations than the other three JSRD children. She had the typical neurological signs with the distinct MTS, retinitis pigmentosa, congenital hepatic fibrosis, as well as ventricular septal defect that was surgically closed at the age of seven years. No NPHP1 mutation was detected in this patient. Homozygous NPHP1 deletions, the most fre­quent NPHP1 mutation known, will be detec­ted with the multiplex approach used in the present study. However, in more than 6% of all NPHP1 cases, the underlying mutation has been found to be a heterozygous deletion com­bined with a single point mutation. [36] As for the patients with no homozygous NPHP1 deletion, we will investigate for heterozygous deletions in a future study by applying the ligation-dependent probe amplification (MLPA) tech­nique. Further analysis of all other NPHP loci for potential homozygosity in consanguineous families by total genome search for linkage using Affimetrix SNP arrays is also consi­dered. Sequencing all exons of NPHP genes located within regions of significant homozygosity is crucial to identify the underlying ge­netic defect.


   Acknowledgment Top


The authors thank the patients and their fami­lies for generously donating DNA samples and clinical information.

 
   References Top

1.Hildebrandt F, Otto E. Cilia and centrosomes: A unifying pathogenic concept for cystic kidney disease? Nat Rev Genet 2005;6:928-930.  Back to cited text no. 1
[PUBMED]    
2.Smith C, Graham J. Congenital medullary cysts of the kidneys with severe refractory anemia Am J Dis Child 1945;69:369-77.  Back to cited text no. 2
    
3.Fanconi G, Hanhart E, von Albertini A, Uhlinger E, Dolivo G, Prader A. Familial, juvenile nephronophthisis (idiopathic parenchymal contracted kidney) [in German]. Helv Pediatr Acta 1951;6:1-49  Back to cited text no. 3
    
4.Hildebrandt F. Juvenile nephronophthisis. In: Harmon WE, Ed, Pediatric Nephrology, Baltimore: Williams & Wilkins; 2004. p.665-73.  Back to cited text no. 4
    
5.Gagnadoux MF, Bacri JL, Broyer M, Habib R. Infantile chronic tubulo-interstitial nephritis with cortical microcysts: Variant of nephronophthisis or new disease entity. Pediatr Nephrol 1989;3:50-5.  Back to cited text no. 5
[PUBMED]    
6.Hildebrandt F, Waldherr R, Kutt R, Brandis M. The nephronophthisis complex: Clinical and genetic aspects. Clin Investig 1992;70:802-8.  Back to cited text no. 6
[PUBMED]    
7.Omran H, Fernandez C, Jung M, et al. Identi­fication of a new gene locus for adolescent nephronophthisis, on chromosome 3q22 in a large Venezuelan pedigree. Am J Hum Genet 2000;66:118-27.  Back to cited text no. 7
[PUBMED]    
8.Senior B, Friedmann AI, Braudo JL. Juvenile familial nephropathy with tapetoretinal dege­neration: A new oculorenal dystrophy. Am J Ophthalmol 1961;52:625-33.  Back to cited text no. 8
[PUBMED]    
9.Boichis H, Passwell J, David R, Miller H. Con­genital hepatic fibrosis and nephronophthisis. A family study. Q J Med 1973;42:221-33.  Back to cited text no. 9
[PUBMED]    
10.Saraiva JM, Baraitser M. Joubert syndrome: A review. Am J Med Genet 1992;43:726-31.  Back to cited text no. 10
[PUBMED]    
11.Saunier S, Morin G, Calado J, Benessay F, Silbermann F, Antignac C. Large deletions of the NPH1 region in Cogan syndrome (CS) associated with familial juvenile nephronophthisis (NPH). Am J Hum Genet 1997;61:A346.  Back to cited text no. 11
    
12.Hildebrandt F, Zhou W. Nephronophthisis-Associated Ciliopathies. J Am Soc Nephrol 2007;18:1855-71.  Back to cited text no. 12
[PUBMED]    
13.Blowey DL, Querfeld U, Geary D, Warady BA, Alon U. Ultrasound findings in juvenile nephronophthisis. Pediatr Nephrol 1996;10:22-4.  Back to cited text no. 13
[PUBMED]    
14.Waldherr R, Lennert T, Weber HP, Fodisch HJ, Scharer K. The nephronophthisis complex. A clinicopathologic study in children. Virchows Arch A Pathol Anat Histol 1982;394:235-54.  Back to cited text no. 14
    
15.Hildebrandt F, Otto E, Rensing C, et al. A novel gene encoding an SH3 domain protein is mutated in nephronophthisis type 1. Nat Gene 1997;17:149-53.  Back to cited text no. 15
[PUBMED]    
16.Saunier S, Calado J, Heilig R, et al. A novel gene that encodes a protein with a putative src homology 3 domain is a candidate gene for familial juvenile nephronophthisis. Hum Mol Genet 1997;6:2317-23.  Back to cited text no. 16
[PUBMED]    
17.Otto EA, Schermer B, Obara T, et al. Muta­tions in INVS encoding inversin cause nephronophthisis type 2, linking renal cystic disease to the function of primary cilia and left-right axis determination. Nat Genet 2003;34:413-20.  Back to cited text no. 17
[PUBMED]    
18.Olbrich H, Fliegauf M, Hoefele J, et al. Mutations in a novel gene, NPHP3, cause adolescent nephronophthisis, tapeto-retinal degeneration and hepatic fibrosis. Nat Genet 2003;34:455-9.  Back to cited text no. 18
[PUBMED]    
19.Mollet G, Salomon R, Gribouval O, , et al. The gene mutated in juvenile nephronophthisis type 4 encodes a novel protein that interacts with nephrocystin. Nat Genet 2002;32:300-5.  Back to cited text no. 19
    
20.Otto E, Hoefele J, Ruf R, et al. A gene mutated in nephronophthisis and retinitis pigmentosa encodes a novel protein, nephroretinin, con­served in evolution. Am J Hum Genet 2002; 71:1167-71.  Back to cited text no. 20
[PUBMED]    
21.Otto E, Loeys B, Khanna H, et al. Nephrocystin-5, a ciliary IQ domain protein, is mutated in Senior-Løken syndrome and interacts with RPGR and calmodulin. Nat Genet 2005;37: 282-8.  Back to cited text no. 21
    
22.Sayer JA, Otto EA, O'Toole JF, et al. The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nat Genet 2006;38:674-81.  Back to cited text no. 22
    
23.Valente EM, Silhavy JL, Brancati F, et al. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome. Nat Genet 2006;38:623-5.  Back to cited text no. 23
    
24.Attanasio M, Uhlenhaut NH, Sousa VH, et al. Loss of GLIS2 causes nephronophthisis in humans and mice by increased apoptosis and fibrosis. Nat Genet 2007;39:1018-24.  Back to cited text no. 24
    
25.Delous M, Baala L, Salomon R, et al. The ciliary gene RPGRIP1L is mutated in cerebello-oculorenal syndrome (Joubert syndrome type B) and Meckel syndrome. Nat Genet 2007;39:875-81.  Back to cited text no. 25
    
26.Wolf MT, Saunier S, O'Toole JF, et al. Mutational analysis of the RPGRIP1L gene in patients with Joubert syndrome and nephronophthisis. Kidney Int 2007;72: 1520-6.  Back to cited text no. 26
    
27.Roepman R, Bernoud-Hubac N, Schick DE, et al. The retinitis pigmentosa GTPase regulator (RPGR) interacts with novel transport-like proteins in the outer segments of rod photo-receptors. Hum Mol Genet 2000;9:2095-105.  Back to cited text no. 27
    
28.Otto EA, Trapp ML, Schultheiss UT, Helou J, Quarmby LM, Hildebrandt F. NEK8 mutations affect ciliary and centrosomal localization and may cause nephronophthisis. J Am Soc Nephrol 2008;19:587-92.  Back to cited text no. 28
    
29.Otto EA, Tory K, Attanasio M, et al. Hypomorphic mutations in meckelin (MKS3/ TMEM67) cause nephronophthisis with liver fibrosis (NPHP11). J Med Genet 2009;46: 663e70.  Back to cited text no. 29
    
30.Davis EE, Zhang Q, Liu Q, et al. TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum. Nat Genet 2011;43:189-96.  Back to cited text no. 30
    
31.O'Toole JF, Liu Y, Davis EE, et al. Individuals with mutations in XPNPEP3, which encodes a mitochondrial protein, develop a nephronophthisis-like nephropathy. J Clin Invest 2010; 120:791-802.  Back to cited text no. 31
    
32.Otto EA, Ramaswami G, Janssen S, et al. Mutation analysis of 18 nephronophthisis asso­ciated ciliopathy disease genes using a DNA pooling and next generation sequencing strategy. J Med Genet 2011;48:88-92.  Back to cited text no. 32
    
33.Hildebrandt F, Attanasio M, Otto E. Nephronophthisis: Disease Mechanisms of a Ciliopathy. J Am Soc Nephrol 2009;20:23-35.  Back to cited text no. 33
    
34.Schwartz GJ, Haycock GB, Edelmann CM, Spitzer A. A simple method estimate of glomerular filtration rate in children derived from body length and plasma creatinine. Pediatrics 1976;58:259-63.  Back to cited text no. 34
    
35.van Rossum LK, Mathot RA, Cransberg K, Zietse R, Vulto AG. Estimation of the glomerular filtration rate in children: Which algo­rithm should be used? Pediatr Nephro 2005l; 20:1769-75.  Back to cited text no. 35
    
36.Otto EA, Helou J, Allen SJ, et al. Mutation analysis in nephronophthisis using a combined approach of homozygosity mapping, CEL I endonuclease cleavage, and direct sequencing. Hum Mutat 2008;29:418-26.  Back to cited text no. 36
    
37.Simms RJ, Eley L, Sayer JA. Nephronophthisis. Eur J Hum Genet 2009;17:406-16.  Back to cited text no. 37
    
38.Soliman NA, Hildebrandt F, Allen SJ, Otto EA, Nabhan MM, Badr AM. Homozygous NPHP1 deletions in Egyptian children with nephronophthisis including an infantile onset patient. Pediatr Nephrol 2010;25:2193-4.  Back to cited text no. 38
    
39.Phillips CL, Miller KJ, Filson AJ, et al. Renal cysts of inv/inv mice resemble early infantile nephronophthisis. J Am Soc Nephrol 2004;15: 1744-55.  Back to cited text no. 39
    
40.Caridi G, Dagnino M, Rossi A, et al. Nephronophthisis type 1 deletion syndrome with neurological symptoms: Prevalence and signi­ficance of the association. Kidney Int 2006; 70:1342-7.  Back to cited text no. 40
    
41.Parisi MA, Bennett CL, Eckert ML, et al. The NPHP1 gene deletion associated with juvenile nephronophthisis is present in a subset of individuals with Joubert syndrome. Am J Hum Genet 2004;75:82-91.  Back to cited text no. 41
    

Top
Correspondence Address:
Neveen A Soliman
Department of Pediatrics, Kasr Al Ainy School of Medicine, Cairo University Center of Pediatric Nephrology and Transplantation, Cairo University, Egyptian Group for Orphan Renal Diseases, Cairo
Egypt
Login to access the Email id


DOI: 10.4103/1319-2442.100968

Get Permissions



    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]

This article has been cited by
1 Next-generation sequencing for research and diagnostics in kidney disease
Kirsten Y. Renkema,Marijn F. Stokman,Rachel H. Giles,Nine V. A. M. Knoers
Nature Reviews Nephrology. 2014;
[Pubmed]
2 Mutation of the Mg2+ transporter SLC41A1 results in a nephronophthisis-like phenotype
Hurd, T.W. and Otto, E.A. and Mishima, E. and Gee, H.Y. and Inoue, H. and Inazu, M. and Yamada, H. and Halbritter, J. and Seki, G. and Konishi, M. and Zhou, W. and Yamane, T. and Murakami, S. and Caridi, G. and Ghiggeri, G. and Abe, T. and Hildebrandt, F.
Journal of the American Society of Nephrology. 2013; 24(6): 967-977
[Pubmed]



 

Top
   
 
 
    Similar in PUBMED
    Search Pubmed for
    Search in Google Scholar for
    Email Alert *
    Add to My List *
* Registration required (free)  
 


 
    Abstract
   Introduction
   Patients and Methods
   Data Analysis
   Results
   Discussion
   Acknowledgment
    References
    Article Figures
    Article Tables
 

 Article Access Statistics
    Viewed1756    
    Printed44    
    Emailed0    
    PDF Downloaded592    
    Comments [Add]    
    Cited by others 2    

Recommend this journal