Home About us Current issue Back issues Submission Instructions Advertise Contact Login   

Search Article 
  
Advanced search 
 
Saudi Journal of Kidney Diseases and Transplantation
Users online: 3159 Home Bookmark this page Print this page Email this page Small font sizeDefault font size Increase font size 
 

Table of Contents   
CASE REPORT  
Year : 2014  |  Volume : 25  |  Issue : 4  |  Page : 854-857
mRNA sequencing of a novel NPHS2 intronic mutation in a child with focal and segmental glomerulosclerosis


1 Pediatric Nephrology, Dialysis and Transplant Unit, Department of Pediatrics, University of Padua, Padua, Italy
2 Laboratory of Pathophysiology of Uremia, Istituto Giannina Gaslini, Genoa, Italy
3 Laboratory of Immunopathology and Molecular Biology of the Kidney, Department of Pediatrics, A.O.-University of Padua, Padua, Italy

Click here for correspondence address and email

Date of Web Publication24-Jun-2014
 

   Abstract 

The NPHS2 gene encodes podocin, a membrane protein that acts as the structural scaffold in podocyte foot processes. NPHS2 mutations are associated with steroid-resistant neph-rotic syndrome (SRNS), with the pathologic variant being focal and segmental glomerulosclerosis (FSGS), an emerging cause of end-stage renal disease in children. We describe a novel NPHS2 sequence variant in a girl with SRNS. Onset occurred at the age of seven years, with edema, hypo-proteinemia, hypoalbuminemia, hypercholesterolemia, hypertriglyceridemia and nephrotic protei-nuria. Renal function was normal and autoimmunity markers were negative. Proteinuria failed to decrease after standard steroid therapy. Renal biopsy showed FSGS. Cyclosporine therapy was instituted, but no remission of proteinuria was achieved and chronic renal failure developed. Mole­cular analysis of the NPHS2 gene revealed a homozygous nucleotide substitution in position c.451+3A>T in intron 3-4. This nucleotide substitution has not been reported in the literature till date. The effect of the detected substitution on podocin protein was demonstrated by renal biopsy RNA extraction and cDNA amplification analysis. This technique had never been applied to a NPHS2 mutation. Based on these results, immunosuppressive drugs were discontinued and conser­vative therapy was undertaken.

How to cite this article:
Benetti E, Caridi G, Centi S, Vella MD, Ghiggeri GM, Artifoni L, Murer L. mRNA sequencing of a novel NPHS2 intronic mutation in a child with focal and segmental glomerulosclerosis. Saudi J Kidney Dis Transpl 2014;25:854-7

How to cite this URL:
Benetti E, Caridi G, Centi S, Vella MD, Ghiggeri GM, Artifoni L, Murer L. mRNA sequencing of a novel NPHS2 intronic mutation in a child with focal and segmental glomerulosclerosis. Saudi J Kidney Dis Transpl [serial online] 2014 [cited 2020 Aug 3];25:854-7. Available from: http://www.sjkdt.org/text.asp?2014/25/4/854/135180

E.B. and G.C. are first co-authors who equally contributed to the paper


   Introduction Top


Steroid-resistant nephrotic syndrome (SRNS) with the pathologic variant of focal and seg-mental glomerulosclerosis (FSGS) is an emer­ging cause of end-stage renal disease (ESRD) in children. NPHS2 is the gene most frequently associated with FSGS. It encodes podocin, a 383-aminoacids membrane protein belonging to the stomatin protein family. [1] It is almost exclu­sively expressed in the kidney, both in meso-nephric podocytes during kidney development and in podocytes of mature glomeruli, where it acts as a structural scaffold in podocyte foot processes and interacts with slit-diaphragm (SD) proteins to facilitate intracellular signaling events. [1],[2]

NPHS2 gene mutations were initially iden­tified in familial forms of autosomal recessive SRNS. [1] NPHS2 homozygous or compound heterozygous mutations in sporadic SRNS cases were subsequently reported. [3] Digenic inheri­tance involving NPHS1 and NPHS2 has also been described. [4]

We describe a novel NPHS2 sequence variant, detected in a seven-year-old girl with SRNS and a histological picture of FSGS. Functional effect of the mutation on podocin protein was demonstrated by renal biopsy mRNA analysis, a technique that had never been applied earlier to an NPHS2 mutation.


   Materials and Methods Top


After obtaining informed consent, genomic DNA was extracted according to the standard procedure. Polymerase chain reaction (PCR) amplification and direct sequencing of all eight exons and their flanking regions of NPHS2 gene was carried out. [5] A fragment of renal tissue, obtained after parents' informed consent, was processed for light microscopy, immuno-histochemical and electron microscopy ana­lysis. Total RNA was extracted from a second fragment of the renal tissue obtained from the proband's biopsy. A specific pair of oligo-nucleotides was synthesized to amplify a 286pb amplimer from nucleotide 399 (NPHS2-399F: TTGTCCTCATTTCCCTGCTC) to nucleotide 687 (NPHS2-687R: GAGGCATTT TCCATT-CGGTA) of the NPHS2 cDNA and the ampli-cons were direct sequenced and analyzed. Bio-informatics analysis was performed by Berkeley Drosophila Genome Project, Netgene2 and Human Splicing Finder servers.


   Case Report Top


The patient was a previously healthy seven-year-old Italian girl referred to our unit for SRNS. The onset of nephrotic syndrome occurred five weeks before admission to our department, with generalized edema, hypopro-teinemia (serum total protein 39 g/L), hypo-albuminemia (albumin 15 g/L), hypercholeste-rolemia (707 mg/dL) and hypertriglyceridemia (570 mg/dL) and nephrotic proteinuria (2.7 g/24 h, corresponding to 115 mg/kg/day). Renal function was normal (creatinine clearance accor­ding to Schwartz formula 135 mL/min/1.73 m [2] ). Hemoglobin, serum electrolytes and the complement components were normal. Auto-antibodies (i.e., anti-neutrophil cytoplasmic anti­body, anti-nuclear antibody, anti-dsDNA anti­body, anti-myeloperoxidase antibody) were negative. Screening for any infection was also negative. The girl had been administered a course of oral prednisone (2 mg/kg/day for 4 weeks), followed by three i.v. methylpredniso-lone pulses (500 mg/m [2] ), with no reduction of proteinuria (5.5 g/24 h, corresponding to 260 mg/kg/day). The renal biopsy showed adhesion of the glomerular tuft to the Bowman's capsule in 30% of the sampled glomeruli, and 10% showed sclerotic lesions; the tubules and inters-titium were normal. The immunofluorescence study was negative. Electron microscopy showed extensive foot process effacement and mesan-gial matrix expansion in the involved glomeruli, consistent with FSGS. Cyclosporine therapy was commenced, but no remission of NS was observed after a 12-month period (proteinuria 8.5 g/24 h, corresponding to 360 mg/kg/day).

Molecular analysis of the NPHS2 gene re­vealed the new homozygous nucleotide substi­tution c.451+3A>T, associated with homozy-gous c.686G>A (p.R229Q) sequence variant [Figure 1]. Molecular analysis was then exten­ded to the girl's parents, who resulted to be heterozygous carriers both of c.451+3A>T and of c.686G>A sequence variations. In silico ana­lysis predicted a marked reduction in the donor splice site at the NPHS2 exon 3. To prove this hypothesis, renal mRNA was analyzed; sequence analysis demonstrated the skipping of the whole NPHS2 exon 3 (73 bp), causing a frame shift that results in a premature termination codon and, thus, in the translation of a truncated pro­tein (p.Val128PhefsX28).
Figure 1: (A) Sequencing chromatograms of the NPHS2 exon 3 and related flanking regions of the patient and her parents compared with the wild type control. (B) Electrophoresis: Agarose gel of PCR products of patient's cDNA compared with the wild type control. (C) Graphical representation of aberrant splicing and patient's cDNA sequencing chromatogram (RNA obtained from renal tissue). The amino acid variation predicting the introduction of a stop codon with truncation of NPHS2 protein is shown below.

Click here to view


Based on these results, calcineurin-inhibitor was discontinued and angiotensin-converting enzyme-inhibitor (Ramipril) therapy was under­taken. On subsequent follow-up, renal function progressively declined and creatinine clearance was 50 mL/min/1.73 m [2] (stage 3 NKF-KDOQI classification) at the last evaluation conducted at the age of 9 years.


   Discussion Top


In the literature, clinical features typically associated with NPHS2 mutations are the histo-logical picture of FSGS, disease onset in the first years of life (<5-10 years), steroid resis­tance and progression to ESRD over a 10-year period. [1],[6] The reported global rate of mutation is approximately 45-55% in familial cases and 30% in sporadic ones. [7]

Our patient carried the sequence variant c.451+3A>T together with c.686G>A (p.R229Q) in homozygosity. R229Q is a well known sequence variant and is now generally regarded as a disease modifier. [5],[8],[9] The c.451+3A>T se­quence variation has not been reported in the literature till date. Most of disease-causing mutations of NPHS2 reside in C-terminal do­mains, which constitute the highly conserved region of homology with stomatin protein family and are essential to podocin homo-oligomerization and interaction with other SD proteins, especially nephrin and CD2AP. [3] Pre­vious studies demonstrated that mutations in the NPHS2 stomatin-homology region alter normal podocin intracellular trafficking and also result in wild-type nephrin mistargeting, suggesting that proteinuria may be caused by a deep alte­ration in SD due to the lack of both its main scaffold components. [10],[11] In our patient, the ana­lysis of renal mRNA allowed to prove a NPHS2 transcript alteration, probably resulting in the translation of a truncated protein of 156 amino acids that lacks the C-terminal part. This is the first case in which renal mRNA sequencing of a NPHS2 mutation was used to precisely define the actual pathogenicity of a NPHS2 intronic mutation. Thus, the availability of renal tissue as a source of RNA was crucial to the final diagnosis.

From a clinical point of view, clinical mani­festations and age of onset in our patient were those of idiopathic NS, and the girl was initially treated with steroids and immunosuppressive agents, according to the SRNS standard proto-cols. [12] Genetic diagnostics led to a completely different therapeutic work-up. Therefore, trans­cript analysis is crucial both in understanding the functional effect of a novel mutation and in the clinical management of the patient, allowing to avoid useless and potentially detrimental the­rapies, including immunosuppressive drugs.

 
   References Top

1.Boute N, Gribouval O, Roselli S, et al. NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet 2000;24:349-54.   Back to cited text no. 1
    
2.Roselli S, Gribouval O, Boute N, et al. Podocin localizes in the kidney to the slit diaphragm area. Am J Pathol 2002;160:131-9.  Back to cited text no. 2
    
3.Weber S, Gribouval O, Esquivel EL, et al. NPHS2 mutation analysis shows genetic hetero­geneity of steroid-resistant nephrotic syndrome and low post-transplant recurrence. Kidney Int 2004;66:571-9.  Back to cited text no. 3
    
4.Caridi G, Gigante M, Ravani P, et al. Clinical features and long-term outcome of nephrotic syndrome associated with heterozygous NPHS1 and NPHS2 mutations. Clin J Am Soc Nephrol 2009;4:1065-72.  Back to cited text no. 4
    
5.Caridi G, Bertelli R, Di Duca M, et al. Broa­dening the spectrum of diseases related to podocin mutations. J Am Soc Nephrol 2003; 14:1278-86.  Back to cited text no. 5
    
6.Ruf RG, Lichtenberger A, Karle SM, et al. Patients with mutations in NPHS2 (podocin) do not respond to standard steroid treatment of nephrotic syndrome. J Am Soc Nephrol 2004; 15:722-32.  Back to cited text no. 6
    
7.Caridi G, Perfumo F, Ghiggeri GM. NPHS2 (Podocin) mutations in nephrotic syndrome. Clinical spectrum and fine mechanisms. Pediatr Res 2005;57:54-61R.  Back to cited text no. 7
    
8.Machuca E, Hummel A, Nevo F, et al. Clinical and epidemiological assessment of steroid-resistant nephrotic syndrome associated with the NPHS2 R229Q variant. Kidney Int 2009;75: 727-35.  Back to cited text no. 8
    
9.Pereira AC, Pereira AB, Mota GF, et al. NPHS2 R229Q functional variant is associated with microalbuminuria in the general population. Kidney Int 2004;65:1026-30.  Back to cited text no. 9
    
10.Roselli S, Moutkine I, Gribouval O, Benmerah A, Antignac C. Plasma membrane targeting of podocin through the classical exocytic pathway: Effect of NPHS2 mutations. Traffic 2004;5:37-44.  Back to cited text no. 10
    
11.Nishibori Y, Liu L, Hosoyamada M, et al. Disease-causing missense mutations in NPHS2 gene alter normal nephrin trafficking to the plasma membrane. Kidney Int 2004;66:1755-65.  Back to cited text no. 11
    
12.Hodson EM, Habashy D, Craig JC. Interven­tions for idiopathic steroid-resistant nephrotic syndrome in children. Cochrane Database Syst Rev 2006;2:CD003594.  Back to cited text no. 12
    

Top
Correspondence Address:
Elisa Benetti
Pediatric Nephrology, Dialysis and Transplant Unit, Department of Pediatrics, University of Padua, Padua
Italy
Login to access the Email id


DOI: 10.4103/1319-2442.135180

PMID: 24969201

Rights and Permissions


    Figures

  [Figure 1]



 

Top
   
 
 
    Similar in PUBMED
    Search Pubmed for
    Search in Google Scholar for
    Email Alert *
    Add to My List *
* Registration required (free)  
 


 
    Abstract
   Introduction
    Materials and Me...
   Case Report
   Discussion
    References
    Article Figures
 

 Article Access Statistics
    Viewed1854    
    Printed24    
    Emailed0    
    PDF Downloaded371    
    Comments [Add]    

Recommend this journal