Home About us Current issue Back issues Submission Instructions Advertise Contact Login   

Search Article 
  
Advanced search 
 
Saudi Journal of Kidney Diseases and Transplantation
Users online: 1655 Home Bookmark this page Print this page Email this page Small font sizeDefault font size Increase font size 
 


 
Table of Contents   
ORIGINAL ARTICLE  
Year : 2015  |  Volume : 26  |  Issue : 6  |  Page : 1190-1198
Adiponectin gene expression in human primary adipocyte culture treated with uremic serum


1 Clinical Chemistry Unit, Institute of Ageing and Chronic Disease, University of Liverpool, Liverpool L69 3GA, United Kindom; Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, University of Hail, Hail, Saudi Arabia
2 Department of Nephrology, Royal Liverpool University Hospital, Liverpool, United Kingdom
3 Clinical Chemistry Unit, Institute of Ageing and Chronic Disease, University of Liverpool, Liverpool L69 3GA, United Kindom

Click here for correspondence address and email

Date of Web Publication30-Oct-2015
 

   Abstract 

End-stage renal disease (ESRD) is accompanied by an increased rate of morbidity and mortality due to cardiovascular disease (CVD). Although renal replacement therapy is required at this stage, it is associated with additional complications such as inflammation and dyslipidemia. It has been suggested that adiponectin has anti-inflammatory properties. We studied the potential role of uremic mileu on the adiponectin expression in human primary adipocyte culture. A cohort of 18 patients with ESRD (hemo-and peritoneal dialysis) and nine healthy controls were analyzed in a prospective cross-sectional study. Single blood samples were taken pre-and post-hemodialysis and in peritoneal dialysis patients. Serum concentrations of total adiponectin (7.95 ± 1.44 μg/mL; 6.73 ± 1.2 μg/mL; 13.7 ± 3.04 μg/mL, respectively) and high molecular weight adiponectin (3.03 ± 1.95 μg/mL; 3.57 ± 2.44 14 μg/mL; 8.02 ± 5 μg/mL respectively) were measured. Other biochemical parameters (cholesterol, low-density lipoprotein cholesterol and triglycerides) were assessed in all groups of patients. Adiponectin gene expression was determined using real-time polymerase chain reaction, and was found to be lower in ESRD patients compared with healthy controls with low dose but not with high-dose treatments. Serum concentrations of total adiponectin and high molecular weight adiponectin were significantly higher in the ESRD versus control group. These results provide an initial insight into understanding the putative role of adipose tissue in contributing to the association of CVD risk in patients with chronic kidney disease.

How to cite this article:
Alouffi S, Howse M, Sharma A, Ranganath L. Adiponectin gene expression in human primary adipocyte culture treated with uremic serum. Saudi J Kidney Dis Transpl 2015;26:1190-8

How to cite this URL:
Alouffi S, Howse M, Sharma A, Ranganath L. Adiponectin gene expression in human primary adipocyte culture treated with uremic serum. Saudi J Kidney Dis Transpl [serial online] 2015 [cited 2019 Jul 18];26:1190-8. Available from: http://www.sjkdt.org/text.asp?2015/26/6/1190/168612

   Introduction Top


Traditionally, adipose tissue was considered to be mainly a storage depot for dietary triglycerides. However, it is now also recognized to be an endocrine organ and one of the more active areas of research. The adipocytes (and other cells in adipose tissue) produce cytokines, chemokines and growth and complement factors that may have a role in endstage renal disease (ESRD). [1],[2] The endocrine function of the adipose tissue involves the production and secretion of a large number of hormones, several of which are the focus of the present study. The best known among these factors is leptin, an adipocyte-derived hormone that acts in the hypothalamus and peripheral tissues to decrease food intake and increase energy expenditure and affects metabolism and other cellular functions. In addition to leptin, many other factors have been identified, including tumor necrosis factor (TNFα), adiponectin (also known as Acrp30 and AdipoQ), plasminogen activator-inhibitor, interleukin-6, resistin, transforming growth factor-β, adiposin and retinol-binding protein. [3],[4]

Adiponectin is produced solely by mature adipocytes and is a member of the soluble defense collagen family. [5],[6] Adiponectin has been observed in three different forms; Low, middle and high molecular weight. [7] The high molecular weight hormone is considered to be the active form. [8] Adiponectin has anti-atherogenic, anti-inflammatory and insulin-sensitizing functions. [6] Adiponectin inhibits oxidized lowdensity lipoprotein (LDL)-mediated cell proliferation, lipid accumulation in monocyte-derived macrophages and transformation of macrophages into foam cells. [1] In contrast to leptin, adiponectin is negatively associated with white adipose tissue mass. [5] Surprisingly, although low plasma adiponectin level is associated with coronary artery disease and type-2 diabetes, it is increased in uremia, suggesting that the kidney may be an important site for degradation and elimination. [1],[9] The influence of renal replacement therapy such as dialysis on long-term prognosis is not fully understood. Dialysis affects the nutritional function of adipose tissue as it has been shown to not correct dyslipidemia. [10] The type of dialysis may also be critical, as patients on peritoneal dialysis (PD) have a more atherogenic lipid profile than patients on hemodialysis (HD). [11] Circulating adipokine concentrations are altered in ESRD with differences between renal replacement therapies. [8] We hypothesized that the retention of "uremic toxins" in ESRD results in adipose tissue dysfunction, affecting both adipokine production and lipoprotein metabolism. This could be a potential link to cardiovascular disease (CVD) in ESRD. The present study is aimed specifically to characterize the role of adipose tissue in the association between ESRD and CVD, with attention focused on adiponectin expression from adipocytes. The gene expression of a key adipokine, adiponectin, using an in vitro human adipocyte culture system in the presence of serum containing uremic toxins, was investigated.


   Materials and Methods Top


Study subjects

A total 28 subjects (18 patients with ESRD and ten healthy controls) were recruited from both the Nephrology Clinics and the Renal Wards of the Royal Liverpool University Hospital. The patients were divided into two groups depending on the type of dialysis: HD group (n = 11), with a mean age of 47.5 ± 5.5 years and a mean body mass index (BMI) of 29.2 ± 5.5 kg/m 2 and continuous ambulatory peritoneal dialysis group (CAPD, n = 7), with a mean age of 48 ± 14.2 years and a mean BMI of 27.58 ± 3.8 kg/m 2 . The control group consisted of ten male subjects matched and recruited from the university's clinical departments (mean age of 45.4 ± 8.1 years and mean BMI of 26.73 ± 3 kg/m 2 ). None of the control subjects or patients had diabetes mellitus; diabetic patients were excluded from the study. Written informed consent was signed from all participants before being enrolled into the study. The study protocol was approved by the Liverpool Research Ethics Committee (app number: 08/H1002/41).

Sampling

Anthropometric examination of patients was performed at basal state one day before the dialysis. All subjects were measured and weighed and BMI was calculated. Blood samples for one measurement were taken before and after the dialysis. Serum was obtained by centrifugation and the samples were subsequently stored in aliquots at −70°C until further analysis.

Hormonal and biochemical assays

Serum levels of adiponectin were measured using a commercial enzyme-linked immunosorbent assay (ELISA) kit (R&D System Inc., Minneapolis, MN, USA). Serum levels of high molecular weight adiponectin were measured by a commercial enzyme-linked immunosorbent assay kit (Alpco, Salem, NH, USA). Biochemical parameters were measured using a Modular Analytics analyzer (Roch Diagnostics GmbH, Mannheim, Germany) and reagent kits were supplied by the manufacturer. All reagents were used according to the manufacturer's instruction and the analytical performance of these methods was within the manufacturer's specifications.

Culture and differentiation of human preadipocytes

Human white pre-adipocytes derived from subcutaneous adipose tissue of a female Caucasian subject (BMI 21; age 44 years) were obtained from PromoCell (Heidelberg, Germany). The pre-adipocytes were cultured in pre-adipocyte growth medium supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin and 0.25 μg/mL amphotericin B (Lonza, Twekesbury, UK) at 37°C in a humidified atmosphere of 5% CO 2 /95% air. The pre-adipocytes were seeded onto 12-well plates and grown until confluence. At confluence, cells were induced to differentiate (Day 0) by incubation for three days in Dulbecco's Modified Eagle's Medium (DMEM)/Ham's F12 (1:1) medium containing 32 μM biotin, 1 μM dexamethasone, 200 μM 3-isobutyl-1-methylxanthine, 100 nM insulin, 11 nM L-thyroxine (all from Sigma, Poole, Dorset, UK), 8 μM rosiglitazone (Glaxo-SmithKline, Uxbridge, UK) and 100 U/mL penicillin, 100 μg/mL streptomycin and 0.25 μg/mL amphotericin B. After induction, cells were further maintained in feeding medium containing 3% fetal calf serum (FCS; Sigma), 100 nM insulin, 32 μM biotin and 1 μM dexamethasone until full differentiation at d12 post-differentiation, confirmed by observing the accumulation of lipid droplets under the microscope.

Treatment with uremic sera

To examine the effect of uremic sera on adiponectin expression and secretion, fully differentiated adipocyte cells were incubated with serum on Days 12-14 post-induction for 4 and 24 h. Adipocyte medium incubated in wells without added serum for the same period was used for the controls. Incubations at each time-point were performed in quadruplicate. Cells were collected directly into 0.5 mL Trizol (Invitrogen, Paisley, UK) for isolation of total RNA. Culture media were collected and centrifuged at 1000 rpm for 10 min to remove cell debris and the supernatant was stored at −40°C until analysis.

Real-time polymerase chain reaction (PCR)

Total RNA was extracted from cells using Trizol (Invitrogen) and the RNA concentration was determined from the absorbance at 260 nm. First-strand cDNA was reverse transcribed from 0.5 μg of total RNA using an iScript first-strand synthesis kit (BioRad, Hercules, CA, USA) in a final volume of 10 μL. Realtime PCR amplification was performed in a final volume of 12.5 μL, containing cDNA (equivalent to 10 ng of RNA), optimized concentrations of primers, TaqMan probe FAMTAMRA and a master mix made from a qPCR core kit (Eurogentec, Seraing, Belgium) using a Stratagene Mx3005P instrument. The sequences of primers and probes for human adiponectin were: (Forward: CCCAAAGAGGAGAGAGGAAGCT; Reverse: GCCAGAGCAATGAGATGCAA; Probe: TTCCCAGATGCCCCAGCAAGTGTAAC; size: 73 bp) and for POL2A: (Forward: ATGGAGATCCCCACCAATATCC; Reverse: CATGGGACTGGGTGCTGAAC; Probe: TGCTGGACCCACC-GGCATGTTC; size: 81 bp). PCR amplification was performed in duplicate using 96well plates and the PCR cycling conditions were as follows: 95°C for 10 min followed by 40 cycles (95°C for 15 s, 60°C for 1 min). Non-template controls were run in parallel. RNA polymerase II subunit A (POL2A) was used as a reference gene and the were results expressed as fold changes of Ct value relative to controls using the 2−ΔΔct formula. [12]

Measurement of secreted adiponectin in the medium

Adiponectin release was measured as adiponectin concentration in cell culture medium using a human adiponectin ELISA kit (R&D System Inc.) and high molecular weight (HMW) adiponectin ELISA kit (ALPCO Diagnostic, Salem, NH, USA) according to the manufacturer's instructions. The sensitivity of the ELISA for total adiponectin and HMW adiponectin were 50 and 0.19 ng/mL, respectively.

Cell viability assessment

Cell viability was determined from the release of lactate dehydrogenase (LDH) into cell culture medium after treatment with serum using a spectrophotometric assay kit (Roche Diagnostics GmbH, Mannheim, Germany). LDH levels were measured by a spectrophotometer at 492 and 620 nm at room temperature.


   Statistical analysis Top


Data are expressed as means ± SEM or means ± SD as appropriate. Student's unpaired t-test was used for comparison of the two groups for the data of normal distribution, while the Mann-Whitney test was used for data of non-Gaussian distribution. Differences were considered as statistically significant when P <0.05.


   Results Top


Anthropometric parameters and clinical characteristics of subjects

Basic clinical characteristics of the ESRD and control groups are listed in [Table 1].
Table 1: Clinical and biochemical characteristics of the patients.

Click here to view


Patients undergoing HD had significantly higher serum triglycerides, LDL-cholesterol and HDL-cholesterol compared with the control group [Table 1]. The groups did not significantly differ with respect to gender, age, BMI and total cholesterol.

Serum total adiponectin and high molecular weight concentrations

Plasma HMW adiponectin concentrations were significantly higher in ESRD patients than in healthy subjects. The PD group presented higher values than HD groups (preand post-) (8.02 ± 5.14 μg/mL vs 3.03 ± 1.95 μg/mL and 3.57 ± 2.44 μg/mL, respectively) [Figure 1]A. For total adiponectin, levels in both ESRD groups (HD and PD) were significantly higher than those in healthy subjects. Also, the PD group showed higher values than the HD groups (preand post-) (13.7 ± 3.04 μg/mL vs 7.95 ± 1.44 μg/mL and 6.73 ± 1.2 μg/mL, respectively) [Figure 1]B.
Figure 1: Circulating adiponectin levels in human subjects.
Serum concentrations of high molecular weight adiponectin (A) and total adiponectin (B) in healthy control subjects (white bars), ESRD patients pre-hemodialysis (grey bars), ESRD patients posthemodialysis (black bars) and ESRD patients on peritoneal dialysis (light grey bars). Values are means ± SEMs (n = 9 for the control group, n = 11 for the HD group and n = 7 for the PD group). Statistical significance is from t test *P <0.05 versus the control group.


Click here to view


Measurement of adiponectin gene expression in human adipocytes

At low-dose serum for 4 h, adiponectin gene expression was down-regulated two-fold, 2.5fold and three-fold in the pre-HD, post-HD and PD groups, respectively [Figure 2]A. However, at 24 h, adiponectin gene expression was found to have no changes [Figure 2]B.
Figure 2: Adiponectin gene expression levels in adipocytes treated with uremic serum.
Differentiated human adipocytes were exposed to low dose A, B and C and high dose D, E and F of human serum collected from healthy (H) and ESRD patients pre- and post-dialysis for 4 and 24 h.
Adiponectin mRNA levels were normalized to human POLR2A and expressed relative to untreated cells.
Results are mean ± SE (11 pre-HD and 11 post-HD, 7 PD and 9 healthy subjects). *P <0.05, **P <0.01.


Click here to view


Comparison of serum treatments from the pre-HD and post-HD groups indicated that there was a significant decrease in adiponectin gene expression of the adipocytes.

Measurement of release of adiponectin by human adipocytes

As shown in [Figure 3], total adiponectin was measured to confirm the expression result. However, no significant change was noted. Human adipocytes treated with PD serum showed higher levels of adiponectin in comparison with the other groups.
Figure 3: Release of adiponectin by human adipocytes.
Adiponectin secretion by human adipocytes in culture. A, B and C with low dose. D , E and F with high dose. The adiponectin was measured by ELISA in culture media of cells after the incubation of serum with low dose a and high dose b for 4 and 24 h, and the results are given as ± SE for groups of three at each time point.


Click here to view



   Discussion Top


CVD is one of the major causes of death in ESRD. However, the mechanism(s) are still not clear but it has been suggested that the uremic environment could be contributing to this association. [9] In addition, uremia-related factors have been shown to play a potential role in the progression of CVD in ESRD patients. [13] A role for adipose tissue has been proposed. The present study was aimed specifically at characterizing the role of adipose tissue in the association between CVD and ESRD, with attention focused on adiponectin expression. The gene expression of adiponectin, using an in vitro human adipocyte culture system, in the presence of serum expected to contain substances and molecules retained in ESRD, collectively termed uremic toxins, was investigated.

Initially, different concentrations of plasma were separated from pre-and post-dialysis blood and then incubated for a certain period (4 and 24 h) with cultured human adipocytes. The first set of analyses examined the impact of ESRD plasma on biological integrity. The most striking result to emerge from the data was that concentrations >15% caused cell death while concentrations <10% resulted in media clotting. As an alternative, the serum was tested, which was found to be more appropriate for culture studies. Further analysis showed that the optimum serum concentration was between 0.5% and 5%.

The next part of the study, adiponectin expression, was investigated in cultured human adipocytes (PromoCell) when exposed to uremic serum. Adiponectin has favorable properties, including anti-atherogenic, anti-inflammatory and insulin-sensitizing effects. [6] Patients with ESRD undergoing PD showed a significant increase in plasma adiponectin levels, both total adiponectin and high molecular weight adiponectin, compared with the healthy control group. A significant difference in circulating adiponectin levels was seen between PD and HD patients. A similar finding has been reported in previous studies. [9],[14] Because adiponectin is a 30 kd molecular weight substance, it is unlikely to be removed by the dialysis process. However, kidneys are important organs for elimination of many factors, including protein hormones; therefore, it is likely that impaired kidney function could lead to adiponectin accumulation in ESRD patients. Moreover, plasma adiponectin levels were found to be reduced markedly after kidney transplantation but still at higher levels compared with healthy subjects. [15] Controversy exists on how the kidneys handle this adipokine. [16]

Uremia-related factors have been shown to play a potential role in the progression of CVD in ESRD patients. [13] Many studies had shown that low levels of adiponectin can be considered a predictor of incident cardiovascular events in ESRD. [17] Moreover, plasma levels of adiponectin have been shown to be negatively associated with metabolic risk factors. [18] Thus, the higher levels of plasma adiponectin could be explained by its anti-atherogenic and insulin-sensitizing protective role.

The higher levels of adiponectin seen in ESRD patients do not appear to be from an increase in adipocyte gene expression. The results showed that gene expression was down-regulated significantly in both HD and PD groups with low serum dose. This finding is consistent with results from previous studies that indicated that adiponectin gene expression in vivo is decreased in patients with ESRD [19] as well as in patients with a high risk of CVD. [20] In one study, there was no difference in adiponectin gene expression in peripheral blood mononuclear cells in patients with ESRD. [21] Moreover, down-regulation of adiponectin mRNA has been reported in experimental models in vitro as a result of ESRD-associated oxidative stress. [22] It has been suggested that uremic toxins might overwhelm the positive effects of adiponectin in the ESRD population. [23] In the optimization experiment in studies performed in this thesis, adiponectin mRNA was seen to be decreased when serum dose increased, suggesting a dose response. The reasons for the acute and rapid suppression of adiponectin expression and secretion are unknown but may include inflammation and oxidative stress, as has been suggested by others. It has been reported that adiponectin gene expression and its release are suppressed by oxidative stress in cultured 3T3-L1 adipocyte. [24] Moreover, low gene expression has been associated with oxidative stress in nondiabetic ESRD patients following adipose tissue biopsy studies. [22] In addition, adiponectinemia has been found to lower gene expression by a feedback mechanism. [19],[25] Because it has been suggested that secretion of adiponectin is under feedback regulation, it could be argued that as adiponectin was increased in the uremic serum that was added to the adipocyte in vitro in the studies described in this thesis, this may have resulted in an auto-regulatory inhibition of adiponectin transcription and secretion. Receptors for adiponectin are present on adipocytes. This argument would also be consistent with a dose effect of the uremic serum seen in our studies. This hypothesis could be refuted by direct addition of adiponectin to the adipocyte cultures, not performed in these studies. Also, healthy serum per se down-regulated adiponectin expression in adipocytes, suggesting a response to unknown humoral components found in serum. [26] It is possible that increased circulating adipokines, other than adiponectin, such as IL-6 and leptin found in this study and others not measured here, could influence the expression and secretion of adiponectin.

There is controversy as to the source of adiponectin from adipose tissue, whether it is mainly from subcutaneous [27] or from the visceral depot. [28] Cultured adipocytes in this study originated from the subcutaneous depot. Different factors such as differentiation capacity, cell viability, serum-containing media and many others might play a role in the expression of adipokines.

Gene expression at the mRNA level is generally informative but not be predictive for that at the protein level. Thus, further investigation for protein detection may allow for a deeper interpretation.

In conclusion, an in vitro system to study the effect of uremic serum on adipose tissue function through adipocyte gene expression was established. The results from the modulation of this in vitro adipocyte assay system not only serves as a convenient and unique model to study mechanisms of disease such as ESRD and its treatments but has also provided an initial insight into understanding the putative role of adipose tissue, contributing to the association of CVD risk in ESRD patients. Data also suggest that normal adipocyte function is altered when exposed to a uremic environment in vitro.

Conflict of Interest

There is no conflict of interest in the publication of this article. We have not submitted any data of this study as an article in any other journals.

 
   References Top

1.
Chudek J, Wiecek A. Adipose tissue, inflammation and endothelial dysfunction. Pharmacol Rep 2006;58 Suppl:81-8.  Back to cited text no. 1
    
2.
Trayhurn P. Adipocyte biology. Obes Rev 2007;8 Suppl 1:41-4.  Back to cited text no. 2
    
3.
Ahima RS, Osei SY. Adipokines in obesity. Front Horm Res 2008;36:182-97.  Back to cited text no. 3
    
4.
Trayhurn P, Wood IS. Adipokines: Inflammation and the pleiotropic role of white adipose tissue. Br J Nutr 2004;92:347-55.  Back to cited text no. 4
    
5.
Ahima RS. Adipose tissue as an endocrine organ. Obesity (Silver Spring) 2006;14 Suppl 5:242S-9S.  Back to cited text no. 5
    
6.
Costacou T, Orchard TJ. Adiponectin: Good, bad, or just plain ugly? Kidney Int 2008;74: 549-51.  Back to cited text no. 6
    
7.
Sowers JR. Endocrine functions of adipose tissue: Focus on adiponectin. Clin Cornerstone 2008;9:32-8.  Back to cited text no. 7
    
8.
Wiecek A, Kokot F, Chudek J, Adamczak M. The adipose tissue - A novel endocrine organ of interest to the nephrologist. Nephrol Dial Transplant 2002;17:191-5.  Back to cited text no. 8
[PUBMED]    
9.
Huang JW, Yen CJ, Chiang HW, Hung KY, Tsai TJ, Wu KD. Adiponectin in peritoneal dialysis patients: A comparison with hemodialysis patients and subjects with normal renal function. Am J Kidney Dis 2004;43: 1047-55.  Back to cited text no. 9
    
10.
Majumdar A, Wheeler DC. Lipid abnormalities in renal disease. J R Soc Med 2000; 93:178-82.  Back to cited text no. 10
    
11.
Prichard SS. Impact of dyslipidemia in endstage renal disease. J Am Soc Nephrol 2003;14 9 Suppl 4:S315-20.  Back to cited text no. 11
    
12.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101-8.  Back to cited text no. 12
    
13.
Madore F. Uremia-related metabolic cardiac risk factors in chronic kidney disease. Semin Dial 2003;16:148-56.  Back to cited text no. 13
    
14.
Bakkaloglu SA, Buyan N, Funahashi T, et al. Adiponectin levels and atherosclerotic risk factors in pediatric chronic peritoneal dialysis patients. Perit Dial Int 2005;25:357-61.  Back to cited text no. 14
    
15.
Chudek J, Adamczak M, Karkoszka H, et al. Plasma adiponectin concentration before and after successful kidney transplantation. Transplant Proc 2003;35:2186-9.  Back to cited text no. 15
    
16.
Kataoka H, Sharma K. Renal handling of adipokines. Contrib Nephrol 2006;151:91-105.  Back to cited text no. 16
    
17.
Adamczak M, Chudek J, Wiecek A. Adiponectin in patients with chronic kidney disease. Semin Dial 2009;22:391-5.  Back to cited text no. 17
    
18.
Zoccali C, Mallamaci F, Tripepi G, et al. Adiponectin, metabolic risk factors, and cardiovascular events among patients with end-stage renal disease. J Am Soc Nephrol 2002;13:134-41.  Back to cited text no. 18
    
19.
Marchlewska A, Stenvinkel P, Lindholm B, et al. Reduced gene expression of adiponectin in fat tissue from patients with end-stage renal disease. Kidney Int 2004;66:46-50.  Back to cited text no. 19
    
20.
Statnick MA, Beavers LS, Conner LJ, et al. Decreased expression of apM1 in omental and subcutaneous adipose tissue of humans with type 2 diabetes. Int J Exp Diabetes Res 2000; 1:81-8.  Back to cited text no. 20
    
21.
Norata GD, Baragetti I, Raselli S, et al. Plasma adiponectin levels in chronic kidney disease patients: Relation with molecular inflammatory profile and metabolic status. Nutr Metab Cardiovasc Dis 2010;20:56-63.  Back to cited text no. 21
    
22.
Barazzoni R, Bernardi A, Biasia F, et al. Low fat adiponectin expression is associated with oxidative stress in nondiabetic humans with chronic kidney disease - Impact on plasma adiponectin concentration. Am J Physiol Regul Integr Comp Physiol 2007;293:R47-54.  Back to cited text no. 22
    
23.
Beige J, Heipmann K, Stumvoll M, Körner A, Kratzsch J. Paradoxical role for adiponectin in chronic renal diseases? An example of reverse epidemiology. Expert Opin Ther Targets 2009;13:163-73.  Back to cited text no. 23
    
24.
Furukawa S, Fujita T, Shimabukuro M, et al. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 2004;114:1752-61.  Back to cited text no. 24
    
25.
Bauche IB, Ait El Mkadem S, Rezsohazy R, et al. Adiponectin downregulates its own production and the expression of its AdipoR2 receptor in transgenic mice. Biochem Biophys Res Commun 2006;345:1414-24.  Back to cited text no. 25
    
26.
Körner A, Wabitsch M, Seidel B, et al. Adiponectin expression in humans is dependent on differentiation of adipocytes and down-regulated by humoral serum components of high molecular weight. Biochem Biophys Res Commun 2005;337:540-50.  Back to cited text no. 26
    
27.
Lihn AS, Bruun JM, He G, Pedersen SB, Jensen PF, Richelsen B. Lower expression of adiponectin mRNA in visceral adipose tissue in lean and obese subjects. Mol Cell Endocrinol 2004;219:9-15.  Back to cited text no. 27
    
28.
Degawa-Yamauchi M, Moss KA, Bovenkerk JE, et al. Regulation of adiponectin expression in human adipocytes: Effects of adiposity, glucocorticoids, and tumor necrosis factor alpha. Obes Res 2005;13:662-9.  Back to cited text no. 28
    

Top
Correspondence Address:
Sultan Alouffi
Department of Clinical Laboratory Sciences College of Applied Medical Sciences, University of Hail, Hail, Saudi Arabia

Login to access the Email id


DOI: 10.4103/1319-2442.168612

PMID: 26586058

Rights and Permissions


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1]



 

Top
   
 
 
    Similar in PUBMED
    Search Pubmed for
    Search in Google Scholar for
    Email Alert *
    Add to My List *
* Registration required (free)  
 


 
    Abstract
   Introduction
    Materials and Me...
   Results
   Statistical analysis
   Discussion
    References
    Article Figures
    Article Tables
 

 Article Access Statistics
    Viewed1361    
    Printed14    
    Emailed0    
    PDF Downloaded274    
    Comments [Add]    

Recommend this journal