Saudi Journal of Kidney Diseases and Transplantation

LETTER TO THE EDITOR
Year
: 2016  |  Volume : 27  |  Issue : 2  |  Page : 417--418

WT1 mutations in steroid-resistant idiopathic nephrotic syndrome


Om P Mishra1, Arun K Singh1, Abhishek Abhinay1, Gopeshwar Narayan2, Rajniti Prasad1, Vineeta V Batra3,  
1 Department of Pediatrics, Institute of Medical Sciences, Banaras Hindu University, Varanasi, India
2 Department of Molecular and Human Genetics, Faculty of Science, Banaras Hindu University, Varanasi, India
3 Department of Pathology, G. B. Pant Hospital, New Delhi, India

Correspondence Address:
Prof. Om P Mishra
Department of Pediatrics, Institute of Medical Sciences, Banaras Hindu University, Varanasi
India




How to cite this article:
Mishra OP, Singh AK, Abhinay A, Narayan G, Prasad R, Batra VV. WT1 mutations in steroid-resistant idiopathic nephrotic syndrome.Saudi J Kidney Dis Transpl 2016;27:417-418


How to cite this URL:
Mishra OP, Singh AK, Abhinay A, Narayan G, Prasad R, Batra VV. WT1 mutations in steroid-resistant idiopathic nephrotic syndrome. Saudi J Kidney Dis Transpl [serial online] 2016 [cited 2021 Sep 19 ];27:417-418
Available from: https://www.sjkdt.org/text.asp?2016/27/2/417/178590


Full Text

To the Editor,

About 10-15% of cases of nephrotic syndrome in children are not responsive to steroids and are defined as steroid-resistant nephrotic syndrome (SRNS). The clinical course is often protracted with unremitting proteinuria. The presentations depend upon their genetic heterogeneity. Three distinct clinical forms of WT1 mutations exist including Denys-Drash syndrome (DDS), Frasier syndrome (FS), and isolated nephrotic syndrome. [1],[2] Both DDS and FS have been associated with male pseudohermaphroditism, progressive glomerulopathy, and occurrence of genitourinary tumors. Histopathological lesions include diffuse mesangial proliferation in DDS and focal and segmental glomerulosclerosis (FSGS) in FS, whereas in isolated SRNS, the glomerular lesions could be FSGS, diffuse mesangial proliferation, or minimal change disease. [2],[3] Mutations in WT1 gene in nephrotic syndrome are restricted to exons 8 and 9, and if present, the treatment response may be affected. [2],[4] Interethnic differences can influence the frequency of this gene mutation. There has been no published information so far regarding its status in the Indian population. Therefore, we screened for the presence of WT1 mutations in our patients with SRNS and also studied their histopathological lesions.

A total of 20 patients of sporadic idiopathic SRNS, aged 1-14 years, were enrolled into the study along with 50 ageand gender-matched healthy normal controls. The protocol of the study was approved by the Institute Ethical Committee and informed consent was taken from the parent of each study subject. The patients were defined as SRNS when there was no remission to prednisolone given at a dose of 2 mg/kg/day for four-week period. Renal biopsy was performed in all the cases and tissues were examined under light and immunofluorescence microscopy. WT1 gene mutations in two exons (Exon 8, Exon 9) were tested. Genomic DNA was isolated from peripheral blood by polymerase chain reaction and directly sequenced. Primers used for Exon 8 were: Forward primer CCTTTAATGAGATCCCCTTTTCC, reverse primer GGGGAAATGTGGGGTGTTTCC and for Exon 9 were: Forward primer CCTCACTGTGCCCACATTGT and reverse primer GCACTATTCCTTCTCTCAACTGAG.

The median age of the study patients was 10 years and there were 10 males. The mean age, blood pressure, serum urea, creatinine, sodium, potassium, and glomerular filtration rate were normal. All patients had edema, proteinuria (spot urine protein/creatinine >2 mg/mg), hypoalbuminemia (serum albumin <2.5 g/dL), and hypercholesterolemia (serum cholesterol >200 mg/dL). Histopathologically, minimal change lesion and FSGS were present in eight patients each, membranoproliferative glomerulonephritis was seen in three patients and one patient had diffuse mesangial proliferation. None of the patients had any urogenital abnormalities. The mutational analysis of WT1 gene in SRNS patients and controls did not show any mutation/polymorphism.

The WT1 gene encodes a transcriptional factor of the zinc finger protein family and is involved in kidney and gonadal development and its expression is restricted to podocytes after birth. The reported incidence of WT1 gene mutations is 5.7-6.4% from different parts of the world, and is more common in female patients [1],[4],[5] Recently, Lipska et al [6] reported that patients with WT1 mutations more frequently presented with chronic kidney disease and hypertension at diagnosis, and had more rapid disease progression. FSGS was equally prevalent in cases with and without mutations, but diffuse mesangial sclerosis was mostly associated with WT1 disease and was present in 34% of cases. [6] Patients with sporadic SRNS patients can be screened for presence of this gene mutation, especially when they have associated ambiguous genitalia for the purpose of gender assignment and monitoring of risk of malignancy. [1] We did not find any WT1 gene mutations in our patients.

In this study, the sample size was small and is a main limitation of this observation. Therefore, a study on larger sample size is required to know the exact incidence and clinical significance of WT1 gene mutation in our population.

 Acknowledgements



The present study was supported by the Department of Science and Technology Purse Grant, Government of India, through the Institute of Medical Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India.

Conflict of interest: None declared.

References

1Cho HY, Lee JH, Choi HJ, et al. WT1 and NPHS2 mutations in Korean children with steroid-resistant nephrotic syndrome. Pediatr Nephrol 2008;23:63-70.
2Chernin G, Vega-Warner V, Schoeb DS, et al. Genotype/phenotype correlation in nephrotic syndrome caused by WT1 mutations. Clin J Am Soc Nephrol 2010;5:1655-62.
3Mucha B, Ozaltin F, Hinkes BG, et al. Members of the APN study group. Mutations in the Wilms' tumor 1 gene cause isolated steroid resistant nephrotic syndrome and occur in exons 8 and 9. Pediatr Res 2006; 59:325-31.
4Ruf RG, Schultheiss M, Lichtenberger A, et al. Prevalence of WT1 mutations in a large cohort of patients with steroid-resistant and steroidsensitive nephrotic syndrome. Kidney Int 2004; 66:564-70.
5Aucella F, Bisceglia L, De Bonis P, et al. WT1 mutations in nephrotic syndrome revisited. High prevalence in young girls, associations and renal phenotypes. Pediatr Nephrol 2006; 21:1393-8.
6Lipska BS, Ranchin B, Iatropoulos P, et al. Genotype-phenotype associations in WT1 glomerulopathy. Kidney Int 2014;85:1169-78.